Lecture-2 Principles of microbiology. الدكتورة أسماء الصالح رقم المكتب 5T201 الموقع: إيميل

Size: px
Start display at page:

Download "Lecture-2 Principles of microbiology. الدكتورة أسماء الصالح رقم المكتب 5T201 الموقع: إيميل"

Transcription

1 الشعبة 140MIC: Microbiology Lecture-2 Principles of microbiology الدكتورة أسماء الصالح رقم المكتب 5T201 الموقع: إيميل

2 Principles of Microbiology Content 1.1 Microbiology and Microorganisms The importance of microorganisms 1.2 Microbial Cells Cell chemistry and key structure Characteristics of living systems Cell functions: coding and metabolism. 1.3 Microorganisms and Their Environments Microbial interaction 1.4 The Impact of Microorganisms on Humans Microorganisms as disease agents Microorganisms and agriculture Microorganisms and food Microorganisms, energy and there environment Microorganisms and their genetic resources Microbiology as a career

3 1.1 Microbiology and Microorganisms The science of microbiology revolves around two themes: 1. Understanding basic life processes (basic biological science). Microbes are excellent models for understanding cellular processes in unicellular and multicellular organisms 2. Applying that knowledge to the benefit of humans (applied biological science) Microbes play important roles in medicine, agriculture, and industry

4 1.1 Microbiology and Microorganisms The importance of microorganisms Oldest and smallest form of life Largest mass of living material on Earth Carry out major processes for biogeochemical cycles Can live in places unsuitable for other organisms Other life forms require microbes to survive

5 1.2 Microbial cell The Cell A dynamic entity that forms the fundamental unit of life Contains 4 chemical components, form 95% of dry weight of the cell: 1. Proteins 2. Nucleic acids 3. Lipids 4. Polysaccharides Nucleus

6 1.2 Microbial cell Cytoplasmic (cell) membrane Barrier that separates the inside of the cell from the outside environment Cell wall Present in most microbes, confers structural strength and prevents the cell from osmotic bursting Nucleus

7 1.2 Microbial cell Cytoplasm: The fluid inside the cell contains various structures and chemicals Nucleus Nucleus or nucleoid: contains 1. DNA (the genome) 2. Ribosomes (consisting proteins) 3. RNA (new proteins are made)

8 1.2 Microbial cell

9 1.2 Microbial cell Characteristics of living systems 1- Compartmentalization and metabolism: Cell Environment A cell is a compartment that takes up nutrients from the environment, transforms them, and releases wastes into the environment. The cell is thus an open system. 2-Growth Chemicals from the environment are turned into new cells under the genetic direction of preexisting cells.

10 1.2 Microbial cell Characteristics of living systems Spore 3- Differentiation Some cells can form new cell structures such as a spore, usually as part of a cellular life cycle. 4- Communication Many cells communicate or interact by means of chemicals that are released or taken up.

11 1.2 Microbial cell Characteristics of living systems 5- Motility Some cells are capable of self-propulsion Ancestral cell Distinct species Distinct species 6- Evolution Cells contain genes and evolve to display new biological properties. Phylogenetic trees show the evolutionary relationships between cells.

12 1.2 Microbial cell Cells as Catalysts and as Coding Devices 1. Cells carry out chemical reactions Enzymes: protein catalysts of the cell that accelerate chemical reactions 2. Cells store and process information that is eventually passed on to offspring during reproduction through DNA (deoxyribonucleic acid) and evolution. Transcription: DNA produces RNA Translation: RNA makes protein

13 Genetic functions Catalytic functions DNA Replication Transcription RNA Translation Energy conservation: ADP P i ATP Metabolism: generation of precursors of macromolecules (sugars, amino acids, fatty acids, etc.) Enzymes: metabolic catalysts Proteins Growth 2012 Pearson Education, Inc.

14 1.3 Microorganisms and Their Environments 1. Microorganisms exist in nature in populations of interacting assemblages called microbial communities. 2. The environment in which a microbial population lives is its habitat 3. Ecosystem refers to all living organisms plus physical and chemical constituents of their environment 4. Microbial ecology is the study of microbes in their natural environment

15 2012 Pearson Education, Inc.

16 2012 Pearson Education, Inc.

17 1.3 Microorganisms and Their Environments 1. Diversity and abundances of microbes are controlled by resources (nutrients) and environmental conditions (e.g., temp, ph, O 2 ) 2. The activities of microbial communities can affect the chemical and physical properties of their habitats

18 1.3 Microorganisms and Their Environments Microbes also interact with their physical and chemical environment Ecosystems greatly influenced (if not controlled) by microbial activities Microorganisms change the chemical and physical properties of their habitats through their activities For example, removal of nutrients from the environment and the excretion of waste products

19 2012 Pearson Education, Inc.

20 ANY QUESTIONS?

21 140MIC: Microbiology 140 حدق: علم األحياء الدقيقة Recommended websites: (small things considered) (society of industrial microbiology and biotechnology) (American society of microbiology) (The Australian society of microbiology) Recommended text books: Brock s biology of microorganisms 12 th edition (Madigan et al. 2009) Microbiology principles and explorations (Black 2008)

Introduction to Bioinformatics

Introduction to Bioinformatics Introduction to Bioinformatics Contents Cell biology Organisms and cells Building blocks of cells How genes encode proteins? Bioinformatics What is bioinformatics? Practical applications Tools and databases

More information

SYLLABUS: 53:154 ENVIRONMENTAL MICROBIOLOGY Assoc. Prof. Timothy E. Mattes Phone: Lectures: Mon/Wed/Fri 12:30 1:20 p.m.

SYLLABUS: 53:154 ENVIRONMENTAL MICROBIOLOGY Assoc. Prof. Timothy E. Mattes Phone: Lectures: Mon/Wed/Fri 12:30 1:20 p.m. SYLLABUS: 53:154 ENVIRONMENTAL MICROBIOLOGY Assoc. Prof. Timothy E. Mattes Phone: 335-5065 Lectures: Mon/Wed/Fri 12:30 1:20 p.m. 3026 SC Labs: Wednesdays 3:30 5:30 p.m. 1246 SC Office Hours: Tues/Thurs

More information

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted

DNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines

More information

Central Dogma. 1. Human genetic material is represented in the diagram below.

Central Dogma. 1. Human genetic material is represented in the diagram below. Central Dogma 1. Human genetic material is represented in the diagram below. 4. If 15% of a DNA sample is made up of thymine, T, what percentage of the sample is made up of cytosine, C? A) 15% B) 35% C)

More information

FARM MICROBIOLOGY 2008 PART 2: BASIC STRUCTURE AND GENETICS OF BACTERIA. 1. Epulopiscium fishelsoni and Thiomargarita namibiensis.

FARM MICROBIOLOGY 2008 PART 2: BASIC STRUCTURE AND GENETICS OF BACTERIA. 1. Epulopiscium fishelsoni and Thiomargarita namibiensis. FARM MICROBIOLOGY 2008 PART 2: BASIC STRUCTURE AND GENETICS OF BACTERIA I. Basic Morphology (Shape) of Vegetative Cells. A. Microscopic. Example Escherichia coli (aka E. coli) is 1.3 µm (= 0.000052 inch)

More information

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1

AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 AGRO/ANSC/BIO/GENE/HORT 305 Fall, 2016 Overview of Genetics Lecture outline (Chpt 1, Genetics by Brooker) #1 - Genetics: Progress from Mendel to DNA: Gregor Mendel, in the mid 19 th century provided the

More information

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function

What is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen

More information

Biochemistry study of the molecular basis of life

Biochemistry study of the molecular basis of life Biochemistry : An Introduction Biochemistry study of the molecular basis of life n Study of the chemistry of living organisms Studies organic molecules & organic reactions in living organisms n Living

More information

SCI204: Honors Biology

SCI204: Honors Biology SCI204: Honors Biology This course provides students with a challenging honors-level biology curriculum, focusing on the chemistry of living things: the cell, genetics, evolution, the structure and function

More information

Reinforcement. Cells and Life CHAPTER 1 LESSON 1

Reinforcement. Cells and Life CHAPTER 1 LESSON 1 Reinforcement Cells and Life LESSON 1 Directions: In numbers 1 through 4 below, a code letter has been substituted for each letter of the alphabet. To find out what the sentence says, use the following

More information

Nitrogen & Bacteria. A biological journey through the environment

Nitrogen & Bacteria. A biological journey through the environment Nitrogen & Bacteria A biological journey through the environment Sources of Nitrogen to the Environment Agricultural Natural Industrial Transportation Nitrogen as a pollutant Too much Nitrogen can cause

More information

DNA Structure and Replication, and Virus Structure and Replication Test Review

DNA Structure and Replication, and Virus Structure and Replication Test Review DNA Structure and Replication, and Virus Structure and Replication Test Review What does DNA stand for? Deoxyribonucleic Acid DNA is what type of macromolecule? DNA is a nucleic acid The building blocks

More information

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes

Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more

More information

Frequency of Keyword Totals - (All LE Regents Exams)

Frequency of Keyword Totals - (All LE Regents Exams) Frequency of Keyword Totals - (All LE Regents Exams) KEYWORD COUNT KEYWORD COUNT ecosystem 58 DNA 48 energy pyramid 19 graph 19 scientific method 19 photosynthesis 43 decomposer 18 human impact 42 clone

More information

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016

Transcription. Unit: DNA. Central Dogma. 2. Transcription converts DNA into RNA. What is a gene? What is transcription? 1/7/2016 Warm Up Questions 1. Where is DNA located? 2. Name the 3 parts of a nucleotide. 3. Enzymes can catalyze many different reactions (T or F) 4. How many variables should you have in an experiment? 5. A red

More information

BIOLOGY EOC STUDY GUIDE Answer Key and Content Focus Report

BIOLOGY EOC STUDY GUIDE Answer Key and Content Focus Report BIOLOGY EOC STUDY GUIDE Answer Key and Content Focus Report 2014-2015 Volusia County Schools 1 The Biology EOC The Biology 1 EOC assessment is delivered via computer-based test. The assessment is given

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are?

DNA. translation. base pairing rules for DNA Replication. thymine. cytosine. amino acids. The building blocks of proteins are? 2 strands, has the 5-carbon sugar deoxyribose, and has the nitrogen base Thymine. The actual process of assembling the proteins on the ribosome is called? DNA translation Adenine pairs with Thymine, Thymine

More information

Bacteria. Bacteria. Chapter 27. Bacteria 7/18/2016

Bacteria. Bacteria. Chapter 27. Bacteria 7/18/2016 Chapter 27 Prokaryotes Most numerous organisms on earth Earliest life forms (fossils: 2.5 billion years old) Contain ribosomes Surrounded by protective cell wall containing peptidoglycan (protein-carbohydrate)

More information

Nucleic acids AP Biology

Nucleic acids AP Biology Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 Nucleic Acids Function: u genetic material DNA stores information w genes w blueprint for building proteins n DNA RNA proteins transfers

More information

RNA & PROTEIN SYNTHESIS

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESIS DNA & RNA Genes are coded DNA instructions that control the production of proteins within the cell. The first step in decoding these genetic messages is to copy part of the nucleotide

More information

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices.

Total Test Questions: 66 Levels: Grades Units of Credit: 1.0 STANDARD 2. Demonstrate appropriate use of personal protective devices. DESCRIPTION Biotechnology is designed to create an awareness of career possibilities in the field of biotechnology. Students are introduced to diagnostic and therapeutic laboratory procedures that support

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

Microbial Growth and The Control of Microbial Growth (Chapter 6 & 7)

Microbial Growth and The Control of Microbial Growth (Chapter 6 & 7) Microbial Growth and The Control of Microbial Growth (Chapter 6 & 7) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Eastern Campus Primary Source for figures and content:

More information

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY

BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested

More information

Review? - What are the four macromolecules?

Review? - What are the four macromolecules? Review? - What are the four macromolecules? Lipids Carbohydrates Protein Nucleic Acids What is the monomer of nucleic acids and what do nucleic acids make up? Nucleotides; DNA and RNA 12-1 DNA DNA Stands

More information

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!!

What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! What happens after DNA Replication??? Transcription, translation, gene expression/protein synthesis!!!! Protein Synthesis/Gene Expression Why do we need to make proteins? To build parts for our body as

More information

Chapter 13 - Concept Mapping

Chapter 13 - Concept Mapping Chapter 13 - Concept Mapping Using the terms and phrases provided below, complete the concept map showing the discovery of DNA structure. amount of base pairs five-carbon sugar purine DNA polymerases Franklin

More information

RNA Structure and the Versatility of RNA. Mitesh Shrestha

RNA Structure and the Versatility of RNA. Mitesh Shrestha RNA Structure and the Versatility of RNA Mitesh Shrestha Ribonucleic Acid (RNA) Nitrogenous Bases (Adenine, Uracil, Guanine, Cytosine) Ribose Sugar Ribonucleic Acid (RNA) Phosphate Group RNA world Hypothesis

More information

Bundle 5 Test Review

Bundle 5 Test Review Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic

More information

CHAPTER 21 LECTURE SLIDES

CHAPTER 21 LECTURE SLIDES CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.

More information

Unit 2 Review: DNA, Protein Synthesis & Enzymes

Unit 2 Review: DNA, Protein Synthesis & Enzymes 1. One of the functions of DNA is to A. secrete vacuoles.. make copies of itself.. join amino acids to each other. D. carry genetic information out of the nucleus. 2. Two sugars found in nucleic acids

More information

Section DNA: The Molecule of Heredity

Section DNA: The Molecule of Heredity Ch 11: DNA and Genes - DNA: The Molecule of Heredity Inside This Section... What is DNA? The Structure of DNA DNA Replication What is DNA? Acid DNA is the blueprint of all living organisms. It controls

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

DNA, Replication and RNA

DNA, Replication and RNA DNA, Replication and RNA The structure of DNA DNA, or Deoxyribonucleic Acid, is the blue prints for building all of life. DNA is a long molecule made up of units called NUCLEOTIDES. Each nucleotide is

More information

Chapter 15 DNA and RNA

Chapter 15 DNA and RNA Chapter 15 DNA and RNA www.mrcbiology.com 1 Variation Variation means that individuals in a species have different characteristics to one another. Acquired Variation are not inherited. e.g learnt during

More information

Introduction, by Tortora, Funke and Case, 11th Ed. TENTATIVE LECTURE OUTLINE DATE TOPIC CHAPTER

Introduction, by Tortora, Funke and Case, 11th Ed. TENTATIVE LECTURE OUTLINE DATE TOPIC CHAPTER MICROBIOLOGY 220 Spring 2014 TTh Section Professor: Scott Rose Text: Microbiology; An Introduction, by Tortora, Funke and Case, 11th Ed. TENTATIVE LECTURE OUTLINE DATE TOPIC CHAPTER Jan. 23 Introduction

More information

The Cell Theory: A Brief History

The Cell Theory: A Brief History The Cell Theory: A Brief History Robert Hooke (1665) observed compartments in cork, under a microscope, and first named cells (the basic unit of biology) His observations were limited by the low magnification

More information

E3120 Microbiology. Learning outcomes. Core content. The course consists of: 1)Lectures. 2) Electronic assigments 3) Exam

E3120 Microbiology. Learning outcomes. Core content. The course consists of: 1)Lectures. 2) Electronic assigments 3) Exam E3120 Microbiology The course consists of: 1)Lectures Tuesday 12.15 14.00 Lecture Room KE 5 Thursday 12.15 14.00 Lecture Room KE 5 2) Electronic assigments 3) Exam Learning outcomes After completing the

More information

BIO 205 Microbiology with Lab (Title Change ONLY Oct. 2013) Course Package. Approved December 10, 2004 Effective Spring 2005

BIO 205 Microbiology with Lab (Title Change ONLY Oct. 2013) Course Package. Approved December 10, 2004 Effective Spring 2005 BIO 205 Microbiology with Lab (Title Change ONLY Oct. 2013) Course Package Approved December 10, 2004 Effective Spring 2005 Modified April 3, 2009 COURSE INFORMATION Title MICROBIOLOGY Number BIO 205 Catalog

More information

Division Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage

Division Ave. High School Ms. Foglia AP Biology. Nucleic acids. AP Biology Nucleic Acids. Information storage Nucleic acids 2006-2007 Nucleic Acids Information storage 2006-2007 1 DNA Nucleic Acids Function: u genetic material stores information w genes w blueprint for building proteins n DNA RNA proteins transfers

More information

Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes.

Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes. Delicious DNA: Transcription and Translation Simulation Using an Edible Model Authors: Darcy Holoweski and Catherine Quist Standards: SC.912.L.16.5: Explain the basic processes of transcription and translation,

More information

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1

1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 1 From the syllabus: 1.5 Nucleic Acids and Their Functions Page 1 S. Preston 1 l. Nucleic

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

An introduction to genetics and molecular biology

An introduction to genetics and molecular biology An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular

More information

Gene Expression Transcription

Gene Expression Transcription Why? ene Expression Transcription How is mrn synthesized and what message does it carry? DN is often referred to as a genetic blueprint. In the same way that blueprints contain the instructions for construction

More information

What Are the Chemical Structures and Functions of Nucleic Acids?

What Are the Chemical Structures and Functions of Nucleic Acids? THE NUCLEIC ACIDS What Are the Chemical Structures and Functions of Nucleic Acids? Nucleic acids are polymers specialized for the storage, transmission, and use of genetic information. DNA = deoxyribonucleic

More information

Aerobic and Anaerobic Biodegradation

Aerobic and Anaerobic Biodegradation Polimernet Plastik San.Tic.Ltd.Şti. Tel:+90 216 393 77 46 / Email: info@polimernet.com www.polimernet.com 1 Aerobic and Anaerobic Biodegradation This document provides an in depth explanation, detailing

More information

DNA - DEOXYRIBONUCLEIC ACID

DNA - DEOXYRIBONUCLEIC ACID DNA - DEOXYRIBONUCLEIC ACID blueprint of life (has the instructions for making an organism) established by James Watson and Francis Crick codes for your genes shape of a double helix made of repeating

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA 18 Lecture: DNA Structure Worksheet 19 Lecture:

More information

Solutions to Quiz II

Solutions to Quiz II MIT Department of Biology 7.014 Introductory Biology, Spring 2005 Solutions to 7.014 Quiz II Class Average = 79 Median = 82 Grade Range % A 90-100 27 B 75-89 37 C 59 74 25 D 41 58 7 F 0 40 2 Question 1

More information

Gene Expression. Student:

Gene Expression. Student: Gene Expression Student: 1. A ribozyme is A. a section of the DNA that is expressed in the mrna. B. a self-splicing intron that acts like an enzyme. C. a complex made up of many ribosomes replicating the

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Los Angeles Unified School District Secondary Science Branch HIGH SCHOOL CORE CLASSES

Los Angeles Unified School District Secondary Science Branch HIGH SCHOOL CORE CLASSES HIGH SCHOOL CORE CLASSES BIOLOGY AB Annual Course-Grades 9-12 Prerequisite: None 36-07-01 BIO A 36-07-02 BIO B Type of Credential Life Science, Science: Biological Science, Biological Science (Specialized).

More information

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs.

DNA vs. RNA B-4.1. Compare DNA and RNA in terms of structure, nucleotides and base pairs. DNA vs. RNA B-4.1 Compare DNA and RNA in terms of structure, nucleotides and base pairs. Key Concepts l Nucleic Acids: l deoxyribonucleic acid (DNA) l ribonucleic acid (RNA) l Nucleotides: l nitrogen base,

More information

Bio 101 Sample questions: Chapter 10

Bio 101 Sample questions: Chapter 10 Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information

More information

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein

CHAPTER 17 FROM GENE TO PROTEIN. Section C: The Synthesis of Protein CHAPTER 17 FROM GENE TO PROTEIN Section C: The Synthesis of Protein 1. Translation is the RNA-directed synthesis of a polypeptide: a closer look 2. Signal peptides target some eukaryotic polypeptides to

More information

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links

translation The building blocks of proteins are? amino acids nitrogen containing bases like A, G, T, C, and U Complementary base pairing links The actual process of assembling the proteins on the ribosome is called? translation The building blocks of proteins are? Complementary base pairing links Define and name the Purines amino acids nitrogen

More information

Technician: Dionne Lutz, BS: Biology & MsED Office: Kanbar Center, Room 704, 41 Cooper Sq. (212) (office)

Technician: Dionne Lutz, BS: Biology & MsED Office: Kanbar Center, Room 704, 41 Cooper Sq. (212) (office) BIO101: Molecular and Cellular Biology (WITH LABS!) Meeting Mondays, 6-9pm, in room 101 or in Kanbar Center on select dates (see schedule). (3 credits) Instructor: Oliver Medvedik, Ph.D Office: Room 206,

More information

Aerobic and Anaerobic Biodegradation. Danny Clark ENSO Bottles LLC 06/29/2010

Aerobic and Anaerobic Biodegradation. Danny Clark ENSO Bottles LLC 06/29/2010 2010 Aerobic and Anaerobic Biodegradation Danny Clark ENSO Bottles LLC 06/29/2010 Aerobic and Anaerobic Biodegradation A look into aerobic and anaerobic biodegradation By Danny Clark ENSO Bottles, LLC

More information

The common structure of a DNA nucleotide. Hewitt

The common structure of a DNA nucleotide. Hewitt GENETICS Unless otherwise noted* the artwork and photographs in this slide show are original and by Burt Carter. Permission is granted to use them for non-commercial, non-profit educational purposes provided

More information

Ch. 10 Notes DNA: Transcription and Translation

Ch. 10 Notes DNA: Transcription and Translation Ch. 10 Notes DNA: Transcription and Translation GOALS Compare the structure of RNA with that of DNA Summarize the process of transcription Relate the role of codons to the sequence of amino acids that

More information

Read and take notes on pages

Read and take notes on pages Protein Synthesis Read and take notes on pages 336-340 What is protein? Proteins Polypeptide chains of amino acids Are enzymes that catalyze biochemical reactions and are vital to metabolism. They have

More information

Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006

Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006 Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006 Faculty Information: Dr. Nitya Jacob, Office: Room 104, Pierce Hall; Phone: 770-784-8346 Office Hours: T 9:30-10:30

More information

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling

DNA DNA Profiling 18. Discuss the stages involved in DNA profiling 19. Define the process of DNA profiling 20. Give two uses of DNA profiling Name: 2.5 Genetics Objectives At the end of this sub section students should be able to: 2.5.1 Heredity and Variation 1. Discuss the diversity of organisms 2. Define the term species 3. Distinguish between

More information

Bundle 6 Test Review

Bundle 6 Test Review Bundle 6 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? Deoxyribonucleic

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

How antimicrobial agents work

How antimicrobial agents work Physical and Chemical Control of Microbes Physical Agents heat or radiation Chemical Agents disinfectants or antiseptics Important Terms 1. Sterilization process of killing all viable microbes 2. Bactericide

More information

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Viruses. Chapter 19. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 19 Viruses PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Prentice Hall Science Explorer: Physical Science 2002 Correlated to: Idaho State Board of Education Achievement Standards for Science (Grades 9-12)

Prentice Hall Science Explorer: Physical Science 2002 Correlated to: Idaho State Board of Education Achievement Standards for Science (Grades 9-12) Idaho State Board of Education Achievement Standards for Science (Grades 9-12) UNIFYING CONCEPTS OF SCIENCE 1. Understand system, order, and organization. A. Know the scientific meaning and application

More information

RNA and Protein Synthesis

RNA and Protein Synthesis RNA and Protein Synthesis CTE: Agriculture and Natural Resources: C5.3 Understand various cell actions, such as osmosis and cell division. C5.4 Compare and contrast plant and animal cells, bacteria, and

More information

PRACTICE TEST ANSWER KEY & SCORING GUIDELINES BIOLOGY

PRACTICE TEST ANSWER KEY & SCORING GUIDELINES BIOLOGY Ohio s State Tests PRACTICE TEST ANSWER KEY & SCORING GUIDELINES BIOLOGY Table of Contents Questions 1 24: Content Summary and Answer Key...iii Question 1: Question and Scoring Guidelines...1 Question

More information

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH

NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH NON MENDELIAN GENETICS. DNA, PROTEIN SYNTHESIS, MUTATIONS DUE DECEMBER 8TH MONDAY TUESDAY WEDNESDAY THURSDAY FRIDAY 11/14 11/15 11/16 11/17 11/18 Non-Mendelian Genetics DNA Structure and Replication 11/28

More information

Prokaryotic Transcription

Prokaryotic Transcription Prokaryotic Transcription Transcription Basics DNA is the genetic material Nucleic acid Capable of self-replication and synthesis of RNA RNA is the middle man Nucleic acid Structure and base sequence are

More information

Chapter 9 Controlling Microbial Growth in the Environment. 10/1/ MDufilho

Chapter 9 Controlling Microbial Growth in the Environment. 10/1/ MDufilho Chapter 9 Controlling Microbial Growth in the Environment 10/1/2017 1 MDufilho Table 91 Terminology of Microbial Control 10/1/2017 MDufilho 2 Number of living microbes Figure 91 A plot of microbial death

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

3. A student performed a gel electrophoresis experiment. The results are represented in the diagram below.

3. A student performed a gel electrophoresis experiment. The results are represented in the diagram below. Base your answers to questions 1 and 2 on the statement below and on your knowledge of biology. Scientists have found a gene in the DNA of a certain plant that could be the key to increasing the amount

More information

Molecular Genetics. Before You Read. Read to Learn

Molecular Genetics. Before You Read. Read to Learn 12 Molecular Genetics section 3 DNA,, and Protein DNA codes for, which guides protein synthesis. What You ll Learn the different types of involved in transcription and translation the role of polymerase

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

AGENDA for 10/10/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES: Due Fri, 10-11

AGENDA for 10/10/13 AGENDA: HOMEWORK: Due end of the period OBJECTIVES: Due Fri, 10-11 AGENDA for 10/10/13 AGENDA: 1. 1.2.3 DNA Analysis Analyzing DNA Samples Using Current Forensic Methods OBJECTIVES: 1. Demonstrate the steps of gel electrophoresis 2. Analyze restriction fragment length

More information

BIOCHEMISTRY Nucleic Acids

BIOCHEMISTRY Nucleic Acids BIOCHEMISTRY Nucleic Acids BIOB111 CHEMISTRY & BIOCHEMISTRY Session 17 Session Plan Types of Nucleic Acids Nucleosides Nucleotides Primary Structure of Nucleic Acids DNA Double Helix DNA Replication Types

More information

Biology 40S: Course Outline Monday-Friday Slot 1, 8:45 AM 9:45 AM Room 311 Teacher: John Howden Phone:

Biology 40S: Course Outline Monday-Friday Slot 1, 8:45 AM 9:45 AM Room 311 Teacher: John Howden   Phone: The course is designed to help students develop and demonstrate an understanding of the biological concepts of genetics and biodiversity through scientific inquiry, problem solving, personal reflection

More information

Ch 10.4 Protein Synthesis

Ch 10.4 Protein Synthesis Ch 10.4 Protein Synthesis I) Flow of Genetic Information A) DNA is made into RNA which undergoes transcription and translation to be made into a protein. II) RNA Structure and Function A) RNA contains

More information

Protein Synthesis & Gene Expression

Protein Synthesis & Gene Expression DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that

More information

Composition of the Microbial World: - Procaryotes: relative simple morphology and lack true membrane delimited nucleus

Composition of the Microbial World: - Procaryotes: relative simple morphology and lack true membrane delimited nucleus Welcome to TL2203 Environmental Microbiology Introduction to the biology of bacterial and archaeal organisms. Topics include microbial cell structure and function, methods of cultivation, genetics, phylogeny

More information

Protein Synthesis Transcription And Translation Lab Answers

Protein Synthesis Transcription And Translation Lab Answers Lab Answers Free PDF ebook Download: Lab Answers Download or Read Online ebook protein synthesis transcription and translation lab answers in PDF Format From The Best User Guide Database 1.. Anatomy and

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

CHAPTERS , 17: Eukaryotic Genetics

CHAPTERS , 17: Eukaryotic Genetics CHAPTERS 14.1 14.6, 17: Eukaryotic Genetics 1. Review the levels of DNA packing within the eukaryote nucleus. Label each level. (A similar diagram is on pg 188 of your textbook.) 2. How do the coding regions

More information

Page 1. Name: 1) Which letter indicates a cell structure that directly controls the movement of molecules into and out of the cell?

Page 1. Name: 1) Which letter indicates a cell structure that directly controls the movement of molecules into and out of the cell? Name: 1) Which letter indicates a cell structure that directly controls the movement of molecules into and out of the cell? A) A B) B C) C D) D 2) A single-celled organism is represented in the diagram

More information

Molecular and Cell Biology (MCB)

Molecular and Cell Biology (MCB) Molecular and Cell Biology (MCB) Head of Department: Professor Michael Lynes Department Office: Room 104, Biology/Physics Building For major requirements, see the College of Liberal Arts and Sciences section

More information

Protein Synthesis Making Proteins

Protein Synthesis Making Proteins Protein Synthesis Making Proteins 2009-2010 Bodies Cells DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA DNA Cells Bodies How does DNA code for cells & bodies?

More information

Genetic Engineering for Biofuels Production

Genetic Engineering for Biofuels Production Genetic Engineering for Biofuels Production WSE 573 Spring 2013 Greeley Beck INTRODUCTION Alternative transportation fuels are needed in the United States because of oil supply insecurity, oil price increases,

More information

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video

DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th. Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video DNA, RNA, PROTEIN SYNTHESIS, AND MUTATIONS UNIT GUIDE Due December 9 th Monday Tuesday Wednesday Thursday Friday 16 CBA History of DNA video 17 History of DNA Create Tellegami or 18 Lecture: DNA Structure

More information

Lecture #8 2/4/02 Dr. Kopeny

Lecture #8 2/4/02 Dr. Kopeny Lecture #8 2/4/02 Dr. Kopeny Lecture VI: Molecular and Genomic Evolution EVOLUTIONARY GENOMICS: The Ups and Downs of Evolution Dennis Normile ATAMI, JAPAN--Some 200 geneticists came together last month

More information

C. Incorrect! Threonine is an amino acid, not a nucleotide base.

C. Incorrect! Threonine is an amino acid, not a nucleotide base. MCAT Biology - Problem Drill 05: RNA and Protein Biosynthesis Question No. 1 of 10 1. Which of the following bases are only found in RNA? Question #01 (A) Ribose. (B) Uracil. (C) Threonine. (D) Adenine.

More information

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases.

What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. What is Bioinformatics? Bioinformatics is the application of computational techniques to the discovery of knowledge from biological databases. Bioinformatics is the marriage of molecular biology with computer

More information

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics

Chapter 8 Lecture Outline. Transcription, Translation, and Bioinformatics Chapter 8 Lecture Outline Transcription, Translation, and Bioinformatics Replication, Transcription, Translation n Repetitive processes Build polymers of nucleotides or amino acids n All have 3 major steps

More information